Did I find the right examples for you? yes no      Crawl my project      Python Jobs

All Samples(17)  |  Call(17)  |  Derive(0)  |  Import(0)

src/b/i/biopython-HEAD/Bio/Align/AlignInfo.py   biopython(Download)
            if isinstance(a, IUPAC.IUPACUnambiguousDNA):
                if ambiguous in IUPAC.IUPACUnambiguousDNA().letters:
                    a = IUPAC.IUPACUnambiguousDNA()
                else:
                    a = Alphabet.generic_dna

src/b/i/biopython-1.63/Bio/Align/AlignInfo.py   biopython(Download)
            if isinstance(a, IUPAC.IUPACUnambiguousDNA):
                if ambiguous in IUPAC.IUPACUnambiguousDNA().letters:
                    a = IUPAC.IUPACUnambiguousDNA()
                else:
                    a = Alphabet.generic_dna

src/b/i/biopython---popgen-HEAD/src/PopGen/Gio/HaplotypesGenerator.py   biopython---popgen(Download)
        if alphabet is None:
            from Bio.Alphabet import IUPAC
            self.alphabet = IUPAC.IUPACUnambiguousDNA()
 
        # Check freqs_per_site and alleles_per_site to be list-like objects with same length

src/b/i/biopython-HEAD/Tests/test_motifs.py   biopython(Download)
    def test_with_alt_alphabet(self):
        """Test motif search using alternative instance of alphabet."""
        self.s = Seq(str(self.s), IUPAC.IUPACUnambiguousDNA())
        self.test_simple()
 

src/b/i/biopython-HEAD/Tests/test_Motif.py   biopython(Download)
    def test_with_alt_alphabet(self):
        """Test motif search using alternative instance of alphabet."""
        self.s = Seq(str(self.s), IUPAC.IUPACUnambiguousDNA())
        self.test_simple()
 

src/b/i/biopython-HEAD/Tests/test_CodonAlign.py   biopython(Download)
        for i in self.aln_file:
            if i[1] == 'parse':
                nucl = SeqIO.parse(i[0][0], 'fasta', alphabet=IUPAC.IUPACUnambiguousDNA())
                prot = AlignIO.read(i[0][1], 'clustal', alphabet=IUPAC.protein)
                with warnings.catch_warnings():
                    warnings.simplefilter('ignore')
                    caln = CodonAlign.build(prot, nucl, alphabet=CodonAlign.default_codon_alphabet)
            elif i[1] == 'index':
                nucl = SeqIO.index(i[0][0], 'fasta', alphabet=IUPAC.IUPACUnambiguousDNA())
                    caln = CodonAlign.build(prot, nucl, alphabet=CodonAlign.default_codon_alphabet, max_score=20)
            elif i[1] == 'id':
                nucl = SeqIO.parse(i[0][0], 'fasta', alphabet=IUPAC.IUPACUnambiguousDNA())
                prot = AlignIO.read(i[0][1], 'clustal', alphabet=IUPAC.protein)
                with open(i[0][2]) as handle:
    def setUp(self):
        # Test set 1
        seq1 = SeqRecord(Seq('TCAGGGACTGCGAGAACCAAGCTACTGCTGCTGCTGGCTGCGCTCTGCGCCGCAGGTGGGGCGCTGGAG', \
                alphabet=IUPAC.IUPACUnambiguousDNA()), id='pro1')
        seq2 = SeqRecord(Seq('TCAGGGACTTCGAGAACCAAGCGCTCCTGCTGCTGGCTGCGCTCGGCGCCGCAGGTGGAGCACTGGAG', \
                alphabet=IUPAC.IUPACUnambiguousDNA()), id='pro2')

src/b/i/biopython-1.63/Tests/test_motifs.py   biopython(Download)
    def test_with_alt_alphabet(self):
        """Test motif search using alternative instance of alphabet."""
        self.s = Seq(str(self.s), IUPAC.IUPACUnambiguousDNA())
        self.test_simple()
 

src/b/i/biopython-1.63/Tests/test_Motif.py   biopython(Download)
    def test_with_alt_alphabet(self):
        """Test motif search using alternative instance of alphabet."""
        self.s = Seq(str(self.s), IUPAC.IUPACUnambiguousDNA())
        self.test_simple()