Did I find the right examples for you? yes no      Crawl my project      Python Jobs

All Samples(6)  |  Call(6)  |  Derive(0)  |  Import(0)
Returns the DNA sequence from an RNA sequence. New Seq object.

>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG",
...                     IUPAC.unambiguous_rna)
>>> messenger_rna
Seq('AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG', IUPACUnambiguousRNA())
>>> messenger_rna.back_transcribe()
Seq('ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG', IUPACUnambiguousDNA())(more...)

src/s/e/seqmagick-0.5.0/seqmagick/transform.py   seqmagick(Download)
        elif transcribe == 'rna2dna':
            rna = Seq(sequence, IUPAC.ambiguous_rna)
            dna = rna.back_transcribe()
            yield SeqRecord(dna, id=name, description=description)
 

src/s/e/seqmagick-HEAD/seqmagick/transform.py   seqmagick(Download)
        elif transcribe == 'rna2dna':
            rna = Seq(sequence, IUPAC.ambiguous_rna)
            dna = rna.back_transcribe()
            yield SeqRecord(dna, id=name, description=description)
 

src/b/i/biopython-HEAD/Tests/test_translate.py   biopython(Download)
s = "GAAAAUUCAUUUUCUUUGGACUUUCUCUGAAAUCCGAGUCCUAGGAAAGAUGCGUGAGAUUCUUCAUAUU"
rna = Seq.Seq(s, IUPAC.unambiguous_rna)
dna = rna.back_transcribe()
assert str(dna)=='GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT'
 

src/b/i/biopython-HEAD/Tests/test_seq.py   biopython(Download)
        continue  # Only Seq has this method
    try:
        print(s.back_transcribe())
        assert False, "Back transcription shouldn't work on a protein!"
    except ValueError:

src/b/i/biopython-1.63/Tests/test_translate.py   biopython(Download)
s = "GAAAAUUCAUUUUCUUUGGACUUUCUCUGAAAUCCGAGUCCUAGGAAAGAUGCGUGAGAUUCUUCAUAUU"
rna = Seq.Seq(s, IUPAC.unambiguous_rna)
dna = rna.back_transcribe()
assert str(dna)=='GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT'
 

src/b/i/biopython-1.63/Tests/test_seq.py   biopython(Download)
        continue  # Only Seq has this method
    try:
        print(s.back_transcribe())
        assert False, "Back transcription shouldn't work on a protein!"
    except ValueError: