Did I find the right examples for you? yes no      Crawl my project      Python Jobs

All Samples(40)  |  Call(36)  |  Derive(0)  |  Import(4)

src/b/i/biopython-1.63/Bio/SeqIO/UniprotIO.py   biopython(Download)
                return SeqFeature.AfterPosition(position)
            elif status == 'less than':
                return SeqFeature.BeforePosition(position)
            elif status == 'uncertain':
                return SeqFeature.UncertainPosition(position)

src/b/i/biopython-1.63/Bio/SeqIO/SwissIO.py   biopython(Download)
    if location_string.startswith("<"):
        try:
            return SeqFeature.BeforePosition(max(0, offset + int(location_string[1:])))
        except ValueError:
            pass

src/b/i/biopython-HEAD/Bio/SeqIO/UniprotIO.py   biopython(Download)
                return SeqFeature.AfterPosition(position)
            elif status == 'less than':
                return SeqFeature.BeforePosition(position)
            elif status == 'uncertain':
                return SeqFeature.UncertainPosition(position)

src/b/i/biopython-HEAD/Bio/SeqIO/SwissIO.py   biopython(Download)
    if location_string.startswith("<"):
        try:
            return SeqFeature.BeforePosition(max(0, offset + int(location_string[1:])))
        except ValueError:
            pass

src/b/i/biopython-1.63/Bio/GenBank/__init__.py   biopython(Download)
    """
    if pos_str.startswith("<"):
        return SeqFeature.BeforePosition(int(pos_str[1:])+offset)
    elif pos_str.startswith(">"):
        return SeqFeature.AfterPosition(int(pos_str[1:])+offset)

src/b/i/biopython-HEAD/Bio/GenBank/__init__.py   biopython(Download)
    """
    if pos_str.startswith("<"):
        return SeqFeature.BeforePosition(int(pos_str[1:])+offset)
    elif pos_str.startswith(">"):
        return SeqFeature.AfterPosition(int(pos_str[1:])+offset)

src/b/i/biopython-1.63/Tests/test_SeqIO_features.py   biopython(Download)
from Bio.SeqRecord import SeqRecord
from Bio.SeqFeature import SeqFeature, FeatureLocation, CompoundLocation
from Bio.SeqFeature import ExactPosition, BeforePosition, AfterPosition, \
                           OneOfPosition,  WithinPosition
 
    def test_simple_dna_join(self):
        """Feature on DNA (join, strand -1, before position)"""
        s = Seq("AAAAACCCCCTTTTTGGGGG", generic_dna)
        f1 = SeqFeature(FeatureLocation(BeforePosition(5), 10), strand=-1)
        f2 = SeqFeature(FeatureLocation(12, 15), strand=-1)
        f1 = SeqFeature(FeatureLocation(5, 10), strand=+1)
        f2 = SeqFeature(FeatureLocation(12, 15), strand=-1)
        f3 = SeqFeature(FeatureLocation(BeforePosition(0), 5), strand=+1)
        f = make_join_feature([f1, f2, f3])
        self.check(s, f, "CCCCC"+reverse_complement("TTT")+"AAAAA",
    def test_protein_join_fuzzy(self):
        """Feature on protein (fuzzy join)"""
        s = Seq("ABCDEFGHIJKLMNOPQRSTUVWXYZ", generic_protein)
        f1 = SeqFeature(FeatureLocation(BeforePosition(5), 10))
        f2 = SeqFeature(FeatureLocation(OneOfPosition(15, (ExactPosition(15),
    def test_fuzzy_join(self):
        """Features: write/read fuzzy join locations."""
        s = "N"*500
        f1 = SeqFeature(FeatureLocation(BeforePosition(10), 20), strand=+1)
        f2 = SeqFeature(FeatureLocation(25, AfterPosition(40)), strand=+1)

src/b/i/biopython-HEAD/Tests/test_SeqIO_features.py   biopython(Download)
from Bio.SeqRecord import SeqRecord
from Bio.SeqFeature import SeqFeature, FeatureLocation, CompoundLocation
from Bio.SeqFeature import ExactPosition, BeforePosition, AfterPosition, \
                           OneOfPosition,  WithinPosition
 
    def test_simple_dna_join(self):
        """Feature on DNA (join, strand -1, before position)"""
        s = Seq("AAAAACCCCCTTTTTGGGGG", generic_dna)
        f1 = SeqFeature(FeatureLocation(BeforePosition(5), 10), strand=-1)
        f2 = SeqFeature(FeatureLocation(12, 15), strand=-1)
        f1 = SeqFeature(FeatureLocation(5, 10), strand=+1)
        f2 = SeqFeature(FeatureLocation(12, 15), strand=-1)
        f3 = SeqFeature(FeatureLocation(BeforePosition(0), 5), strand=+1)
        f = make_join_feature([f1, f2, f3])
        self.check(s, f, "CCCCC"+reverse_complement("TTT")+"AAAAA",
    def test_protein_join_fuzzy(self):
        """Feature on protein (fuzzy join)"""
        s = Seq("ABCDEFGHIJKLMNOPQRSTUVWXYZ", generic_protein)
        f1 = SeqFeature(FeatureLocation(BeforePosition(5), 10))
        f2 = SeqFeature(FeatureLocation(OneOfPosition(15, (ExactPosition(15),
    def test_fuzzy_join(self):
        """Features: write/read fuzzy join locations."""
        s = "N"*500
        f1 = SeqFeature(FeatureLocation(BeforePosition(10), 20), strand=+1)
        f2 = SeqFeature(FeatureLocation(25, AfterPosition(40)), strand=+1)

src/b/i/biopython-1.63/Tests/test_SeqRecord.py   biopython(Download)
from Bio.SeqRecord import SeqRecord
from Bio.SeqFeature import SeqFeature, FeatureLocation, ExactPosition
from Bio.SeqFeature import WithinPosition, BeforePosition, AfterPosition, OneOfPosition
 
 
    def setUp(self) :
        f0 = SeqFeature(FeatureLocation(0, 26), type="source",
                        qualifiers={"mol_type":["fake protein"]})
        f1 = SeqFeature(FeatureLocation(0, ExactPosition(10)))
        f2 = SeqFeature(FeatureLocation(WithinPosition(12, left=12, right=15), BeforePosition(22)))

src/b/i/biopython-HEAD/Tests/test_SeqRecord.py   biopython(Download)
from Bio.SeqRecord import SeqRecord
from Bio.SeqFeature import SeqFeature, FeatureLocation, ExactPosition
from Bio.SeqFeature import WithinPosition, BeforePosition, AfterPosition, OneOfPosition
 
 
    def setUp(self) :
        f0 = SeqFeature(FeatureLocation(0, 26), type="source",
                        qualifiers={"mol_type":["fake protein"]})
        f1 = SeqFeature(FeatureLocation(0, ExactPosition(10)))
        f2 = SeqFeature(FeatureLocation(WithinPosition(12, left=12, right=15), BeforePosition(22)))

  1 | 2  Next