Did I find the right examples for you? yes no      Crawl my project      Python Jobs

All Samples(8)  |  Call(6)  |  Derive(0)  |  Import(2)

src/b/i/biopython-HEAD/Tests/test_SeqUtils.py   biopython(Download)
from Bio.SeqUtils.lcc import lcc_simp, lcc_mult
from Bio.SeqUtils.CheckSum import crc32, crc64, gcg, seguid
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
 
 
    def test_codon_usage_ecoli(self):
        """Test Codon Adaptation Index (CAI) using default E. coli data."""
        CAI = CodonAdaptationIndex()
        self.assertEqual("%0.5f" % CAI.cai_for_gene("ATGCGTATCGATCGCGATACGATTAGGCGGATG"),
                         "0.09978")
            SeqIO.write(records, handle, "fasta")
 
        CAI = CodonAdaptationIndex()
        # Note - this needs a FASTA file which containing non-ambiguous DNA coding
        # sequences - which should each be a whole number of codons.

src/b/i/biopython-HEAD/Tests/test_CodonUsage.py   biopython(Download)
 
# first make a CAI object
X = CodonUsage.CodonAdaptationIndex()
# now generate an index from a file
if os.path.exists("./CodonUsage/HighlyExpressedGenes.txt"):

src/b/i/biopython-1.63/Tests/test_SeqUtils.py   biopython(Download)
from Bio.SeqUtils.lcc import lcc_simp, lcc_mult
from Bio.SeqUtils.CheckSum import crc32, crc64, gcg, seguid
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
 
 
    def test_codon_usage_ecoli(self):
        """Test Codon Adaptation Index (CAI) using default E. coli data."""
        CAI = CodonAdaptationIndex()
        self.assertEqual("%0.5f" % CAI.cai_for_gene("ATGCGTATCGATCGCGATACGATTAGGCGGATG"),
                         "0.09978")
            SeqIO.write(records, handle, "fasta")
 
        CAI = CodonAdaptationIndex()
        # Note - this needs a FASTA file which containing non-ambiguous DNA coding
        # sequences - which should each be a whole number of codons.

src/b/i/biopython-1.63/Tests/test_CodonUsage.py   biopython(Download)
 
# first make a CAI object
X = CodonUsage.CodonAdaptationIndex()
# now generate an index from a file
if os.path.exists("./CodonUsage/HighlyExpressedGenes.txt"):