Did I find the right examples for you? yes no      Crawl my project      Python Jobs

All Samples(2)  |  Call(2)  |  Derive(0)  |  Import(0)

src/b/i/biopython-1.63/Tests/test_CodonUsage.py   biopython(Download)
print("-" * 60)
print("codon adaptation index for test gene: %.2f" % X.cai_for_gene("ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA"))

src/b/i/biopython-HEAD/Tests/test_CodonUsage.py   biopython(Download)
print("-" * 60)
print("codon adaptation index for test gene: %.2f" % X.cai_for_gene("ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA"))