Did I find the right examples for you? yes no      Crawl my project      Python Jobs

All Samples(6)  |  Call(4)  |  Derive(0)  |  Import(2)
Returns DNA/DNA tm using nearest neighbor thermodynamics.

dnac is DNA concentration [nM]
saltc is salt concentration [mM].
rna=0 is for DNA/DNA (default), use 1 for RNA/RNA hybridisation.

For DNA/DNA, see Allawi & SantaLucia (1997), Biochemistry 36: 10581-10594
For RNA/RNA, see Xia et al (1998), Biochemistry 37: 14719-14735

Example:(more...)

        def Tm_staluc(s, dnac=50, saltc=50, rna=0):
    """Returns DNA/DNA tm using nearest neighbor thermodynamics.

    dnac is DNA concentration [nM]
    saltc is salt concentration [mM].
    rna=0 is for DNA/DNA (default), use 1 for RNA/RNA hybridisation.

    For DNA/DNA, see Allawi & SantaLucia (1997), Biochemistry 36: 10581-10594
    For RNA/RNA, see Xia et al (1998), Biochemistry 37: 14719-14735

    Example:

    >>> print("%0.2f" % Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA'))
    59.87
    >>> print("%0.2f" % Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA', rna=True))
    68.14

    You can also use a Seq object instead of a string,

    >>> from Bio.Seq import Seq
    >>> from Bio.Alphabet import generic_nucleotide
    >>> s = Seq('CAGTCAGTACGTACGTGTACTGCCGTA', generic_nucleotide)
    >>> print("%0.2f" % Tm_staluc(s))
    59.87
    >>> print("%0.2f" % Tm_staluc(s, rna=True))
    68.14

    """

    #Credits:
    #Main author: Sebastian Bassi 
    #Overcount function: Greg Singer 
    #Based on the work of Nicolas Le Novere  Bioinformatics.
    #17:1226-1227(2001)

    #This function returns better results than EMBOSS DAN because it uses
    #updated thermodynamics values and takes into account inicialization
    #parameters from the work of SantaLucia (1998).

    #Things to do:
    #+Detect complementary sequences. Change K according to result.
    #+Add support for heteroduplex (see Sugimoto et al. 1995).
    #+Correction for Mg2+. Now supports only monovalent ions.
    #+Put thermodinamics table in a external file for users to change at will
    #+Add support for danglings ends (see Le Novele. 2001) and mismatches.

    dh = 0  # DeltaH. Enthalpy
    ds = 0  # deltaS Entropy

    def tercorr(stri):
        deltah = 0
        deltas = 0
        if rna == 0:
            #DNA/DNA
            #Allawi and SantaLucia (1997). Biochemistry 36 : 10581-10594
            if stri.startswith('G') or stri.startswith('C'):
                deltah -= 0.1
                deltas += 2.8
            elif stri.startswith('A') or stri.startswith('T'):
                deltah -= 2.3
                deltas -= 4.1
            if stri.endswith('G') or stri.endswith('C'):
                deltah -= 0.1
                deltas += 2.8
            elif stri.endswith('A') or stri.endswith('T'):
                deltah -= 2.3
                deltas -= 4.1
            dhL = dh + deltah
            dsL = ds + deltas
            return dsL, dhL
        elif rna == 1:
            #RNA
            if stri.startswith('G') or stri.startswith('C'):
                deltah -= 3.61
                deltas -= 1.5
            elif stri.startswith('A') or stri.startswith('T') or \
                 stri.startswith('U'):
                deltah -= 3.72
                deltas += 10.5
            if stri.endswith('G') or stri.endswith('C'):
                deltah -= 3.61
                deltas -= 1.5
            elif stri.endswith('A') or stri.endswith('T') or \
                 stri.endswith('U'):
                deltah -= 3.72
                deltas += 10.5
            dhL = dh + deltah
            dsL = ds + deltas
            # print("delta h=%f" % dhL)
            return dsL, dhL
        else:
            raise ValueError("rna = %r not supported" % rna)

    def overcount(st, p):
        """Returns how many p are on st, works even for overlapping"""
        ocu = 0
        x = 0
        while True:
            try:
                i = st.index(p, x)
            except ValueError:
                break
            ocu += 1
            x = i + 1
        return ocu

    R = 1.987  # universal gas constant in Cal/degrees C*Mol
    sup = str(s).upper()  # turn any Seq object into a string (need index method)
    vsTC, vh = tercorr(sup)
    vs = vsTC

    k = (dnac/4.0)*1e-9
    #With complementary check on, the 4.0 should be changed to a variable.

    if rna == 0:
        #DNA/DNA
        #Allawi and SantaLucia (1997). Biochemistry 36 : 10581-10594
        vh = vh + (overcount(sup, "AA"))*7.9 + (overcount(sup, "TT"))*\
        7.9 + (overcount(sup, "AT"))*7.2 + (overcount(sup, "TA"))*7.2 \
        + (overcount(sup, "CA"))*8.5 + (overcount(sup, "TG"))*8.5 + \
        (overcount(sup, "GT"))*8.4 + (overcount(sup, "AC"))*8.4
        vh = vh + (overcount(sup, "CT"))*7.8+(overcount(sup, "AG"))*\
        7.8 + (overcount(sup, "GA"))*8.2 + (overcount(sup, "TC"))*8.2
        vh = vh + (overcount(sup, "CG"))*10.6+(overcount(sup, "GC"))*\
        9.8 + (overcount(sup, "GG"))*8 + (overcount(sup, "CC"))*8
        vs = vs + (overcount(sup, "AA"))*22.2+(overcount(sup, "TT"))*\
        22.2 + (overcount(sup, "AT"))*20.4 + (overcount(sup, "TA"))*21.3
        vs = vs + (overcount(sup, "CA"))*22.7+(overcount(sup, "TG"))*\
        22.7 + (overcount(sup, "GT"))*22.4 + (overcount(sup, "AC"))*22.4
        vs = vs + (overcount(sup, "CT"))*21.0+(overcount(sup, "AG"))*\
        21.0 + (overcount(sup, "GA"))*22.2 + (overcount(sup, "TC"))*22.2
        vs = vs + (overcount(sup, "CG"))*27.2+(overcount(sup, "GC"))*\
        24.4 + (overcount(sup, "GG"))*19.9 + (overcount(sup, "CC"))*19.9
        ds = vs
        dh = vh
    elif rna == 1:
        #RNA/RNA hybridisation of Xia et al (1998)
        #Biochemistry 37: 14719-14735
        vh = vh+(overcount(sup, "AA"))*6.82+(overcount(sup, "TT"))*6.6+\
        (overcount(sup, "AT"))*9.38 + (overcount(sup, "TA"))*7.69+\
        (overcount(sup, "CA"))*10.44 + (overcount(sup, "TG"))*10.5+\
        (overcount(sup, "GT"))*11.4 + (overcount(sup, "AC"))*10.2
        vh = vh + (overcount(sup, "CT"))*10.48 + (overcount(sup, "AG"))\
        *7.6+(overcount(sup, "GA"))*12.44+(overcount(sup, "TC"))*13.3
        vh = vh + (overcount(sup, "CG"))*10.64 + (overcount(sup, "GC"))\
        *14.88+(overcount(sup, "GG"))*13.39+(overcount(sup, "CC"))*12.2
        vs = vs + (overcount(sup, "AA"))*19.0 + (overcount(sup, "TT"))*\
        18.4+(overcount(sup, "AT"))*26.7+(overcount(sup, "TA"))*20.5
        vs = vs + (overcount(sup, "CA"))*26.9 + (overcount(sup, "TG"))*\
        27.8 + (overcount(sup, "GT"))*29.5 + (overcount(sup, "AC"))*26.2
        vs = vs + (overcount(sup, "CT"))*27.1 + (overcount(sup, "AG"))*\
        19.2 + (overcount(sup, "GA"))*32.5 + (overcount(sup, "TC"))*35.5
        vs = vs + (overcount(sup, "CG"))*26.7 + (overcount(sup, "GC"))\
        *36.9 + (overcount(sup, "GG"))*32.7 + (overcount(sup, "CC"))*29.7
        ds = vs
        dh = vh
    else:
        raise ValueError("rna = %r not supported" %rna)

    ds = ds-0.368*(len(s)-1)*math.log(saltc/1e3)
    tm = ((1000* (-dh))/(-ds+(R * (math.log(k)))))-273.15
    # print("ds=%f" % ds)
    # print("dh=%f" % dh)
    return tm
        


src/p/y/pydna-0.6.1/pydna/amplify.py   pydna(Download)
from Bio.SeqRecord                  import SeqRecord
from Bio.SeqUtils                   import GC
from Bio.SeqUtils.MeltingTemp       import Tm_staluc
from Bio.SeqFeature                 import SeqFeature
from Bio.SeqFeature                 import CompoundLocation
        self.saltc = saltc
 
        self.tmf = Tm_staluc(str(self.forward_primer.footprint),dnac=50, saltc=self.saltc)
        self.tmr = Tm_staluc(str(self.reverse_primer.footprint),dnac=50, saltc=self.saltc)
        self.tmf_dbd = tmbresluc(str(self.forward_primer.footprint),primerc=self.forward_primer_concentration)

src/p/y/python-dna-0.1.2/pydna/amplify.py   python-dna(Download)
from Bio.SeqRecord                  import SeqRecord
from Bio.SeqUtils                   import GC
from Bio.SeqUtils.MeltingTemp       import Tm_staluc
from Bio.SeqFeature                 import SeqFeature
from Bio.SeqFeature                 import FeatureLocation
 
       '''
        self.tmf = Tm_staluc(str(self.forward_primer.footprint),dnac=50, saltc=self.saltc)
        self.tmr = Tm_staluc(str(self.reverse_primer.footprint),dnac=50, saltc=self.saltc)
        '''