Did I find the right examples for you? yes no      Crawl my project      Python Jobs

All Samples(389)  |  Call(285)  |  Derive(0)  |  Import(104)

src/b/i/biopython-1.63/Bio/Blast/NCBIWWW.py   biopython(Download)
from __future__ import print_function
 
from Bio._py3k import StringIO
from Bio._py3k import _as_string, _as_bytes
from Bio._py3k import urlopen as _urlopen
            break
 
    return StringIO(results)
 
 

src/b/i/biopython-HEAD/Bio/Blast/NCBIWWW.py   biopython(Download)
from __future__ import print_function
 
from Bio._py3k import StringIO
from Bio._py3k import _as_string, _as_bytes
from Bio._py3k import urlopen as _urlopen
            break
 
    return StringIO(results)
 
 

src/b/i/biopython-1.63/Bio/AlignIO/PhylipIO.py   biopython(Download)
"""
 
    from Bio._py3k import StringIO
    handle = StringIO(phylip_text)
    count = 0
Tax5        CCATCTCACGGTCGGTAAGATACACCTGCTTTTGGCGGGAAATGGTCAATATTAAAAGGT"""
 
    handle = StringIO(phylip_text2)
    list2 = list(PhylipIterator(handle))
    handle.close()
    assert len(list2) == 1
    assert len(list2[0]) == 5
 
    handle = StringIO(phylip_text3)
Gorilla   AAACCCTTGC CGGTACGCTT AAACCATTGC CGGTACGCTT AA"""
 
    handle = StringIO(phylip_text4)
    list4 = list(PhylipIterator(handle))
    handle.close()

src/b/i/biopython-HEAD/Bio/AlignIO/PhylipIO.py   biopython(Download)
"""
 
    from Bio._py3k import StringIO
    handle = StringIO(phylip_text)
    count = 0
Tax5        CCATCTCACGGTCGGTAAGATACACCTGCTTTTGGCGGGAAATGGTCAATATTAAAAGGT"""
 
    handle = StringIO(phylip_text2)
    list2 = list(PhylipIterator(handle))
    handle.close()
    assert len(list2) == 1
    assert len(list2[0]) == 5
 
    handle = StringIO(phylip_text3)
Gorilla   AAACCCTTGC CGGTACGCTT AAACCATTGC CGGTACGCTT AA"""
 
    handle = StringIO(phylip_text4)
    list4 = list(PhylipIterator(handle))
    handle.close()

src/b/i/biopython-1.63/Bio/GenBank/Scanner.py   biopython(Download)
 
if __name__ == "__main__":
    from Bio._py3k import StringIO
 
    gbk_example = \
 
    g = GenBankScanner()
    for record in g.parse_cds_features(StringIO(gbk_example)):
        print(record)
 
    g = GenBankScanner()
    for record in g.parse_cds_features(StringIO(gbk_example2),
 
    g = GenBankScanner()
    for record in g.parse_cds_features(StringIO(gbk_example + "\n" + gbk_example2),
                                       tags2id=('gene', 'locus_tag', 'product')):
        print(record)
    print("=================")
    g = GenBankScanner()
    for record in g.parse_records(StringIO(gbk_example), do_features=False):
        print("%s %s %s" % (record.id, record.name, record.description))
        print(record.seq)

src/b/i/biopython-1.63/Bio/AlignIO/ClustalIO.py   biopython(Download)
"""
 
    from Bio._py3k import StringIO
 
    alignments = list(ClustalIterator(StringIO(aln_example1)))
          "VPTTRAQRRA"
 
    alignments = list(ClustalIterator(StringIO(aln_example2)))
    assert 1 == len(alignments)
    assert alignments[0]._version == "1.83"
          "LKAKKIDAIMSSLSITEKRQQEIAFTDKLYAADSRLV"
 
    for alignment in ClustalIterator(StringIO(aln_example2 + aln_example1)):
        print("Alignment with %i records of length %i" \
              % (len(alignment),
                 alignment.get_alignment_length()))
 
    print("Checking empty file...")
    assert 0 == len(list(ClustalIterator(StringIO(""))))

src/b/i/biopython-HEAD/Bio/GenBank/Scanner.py   biopython(Download)
 
if __name__ == "__main__":
    from Bio._py3k import StringIO
 
    gbk_example = \
 
    g = GenBankScanner()
    for record in g.parse_cds_features(StringIO(gbk_example)):
        print(record)
 
    g = GenBankScanner()
    for record in g.parse_cds_features(StringIO(gbk_example2),
 
    g = GenBankScanner()
    for record in g.parse_cds_features(StringIO(gbk_example + "\n" + gbk_example2),
                                       tags2id=('gene', 'locus_tag', 'product')):
        print(record)
    print("=================")
    g = GenBankScanner()
    for record in g.parse_records(StringIO(gbk_example), do_features=False):
        print("%s %s %s" % (record.id, record.name, record.description))
        print(record.seq)

src/b/i/biopython-HEAD/Bio/AlignIO/ClustalIO.py   biopython(Download)
"""
 
    from Bio._py3k import StringIO
 
    alignments = list(ClustalIterator(StringIO(aln_example1)))
          "VPTTRAQRRA"
 
    alignments = list(ClustalIterator(StringIO(aln_example2)))
    assert 1 == len(alignments)
    assert alignments[0]._version == "1.83"
          "LKAKKIDAIMSSLSITEKRQQEIAFTDKLYAADSRLV"
 
    for alignment in ClustalIterator(StringIO(aln_example2 + aln_example1)):
        print("Alignment with %i records of length %i" \
              % (len(alignment),
                 alignment.get_alignment_length()))
 
    print("Checking empty file...")
    assert 0 == len(list(ClustalIterator(StringIO(""))))

src/b/i/biopython-1.63/Bio/AlignIO/EmbossIO.py   biopython(Download)
#---------------------------------------"""
 
    from Bio._py3k import StringIO
 
    alignments = list(EmbossIterator(StringIO(pair_example)))
           == ["IXI_234", "IXI_235"]
 
    alignments = list(EmbossIterator(StringIO(simple_example)))
    assert len(alignments) == 1
    assert len(alignments[0]) == 4
    assert [r.id for r in alignments[0]] \
           == ["IXI_234", "IXI_235", "IXI_236", "IXI_237"]
 
    alignments = list(EmbossIterator(StringIO(pair_example + simple_example)))
           == ["IXI_234", "IXI_235", "IXI_236", "IXI_237"]
 
    alignments = list(EmbossIterator(StringIO(pair_example2)))
    assert len(alignments) == 5
    assert len(alignments[0]) == 2

src/b/i/biopython-HEAD/Bio/AlignIO/EmbossIO.py   biopython(Download)
#---------------------------------------"""
 
    from Bio._py3k import StringIO
 
    alignments = list(EmbossIterator(StringIO(pair_example)))
           == ["IXI_234", "IXI_235"]
 
    alignments = list(EmbossIterator(StringIO(simple_example)))
    assert len(alignments) == 1
    assert len(alignments[0]) == 4
    assert [r.id for r in alignments[0]] \
           == ["IXI_234", "IXI_235", "IXI_236", "IXI_237"]
 
    alignments = list(EmbossIterator(StringIO(pair_example + simple_example)))
           == ["IXI_234", "IXI_235", "IXI_236", "IXI_237"]
 
    alignments = list(EmbossIterator(StringIO(pair_example2)))
    assert len(alignments) == 5
    assert len(alignments[0]) == 2

  1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9  Next