Did I find the right examples for you? yes no

All Samples(436)  |  Call(436)  |  Derive(0)  |  Import(0)

src/p/y/pynast-1.2.2/pynast/util.py   pynast(Download)
            pass
 
    return (DNA.makeSequence(''.join(template_result)), \
            DNA.makeSequence(''.join(candidate_result)),\
            new_gaps_in_pw_alignment)           
        del candidate_l[nearest_gap(candidate_l,pos)]
 
    return (DNA.makeSequence(''.join(template_l)), \
            DNA.makeSequence(''.join(candidate_l)))
 
 
    # return the sequence with the 5' and 3' gaps added
    return DNA.makeSequence(''.join([\
     '-'*five_prime_gaps_to_add,\
     str(aligned_candidate),\

src/c/o/cogent-1.5.3/cogent/db/ensembl/region.py   cogent(Download)
                    seq = get_sequence(alt_loc)
                except NoItemError:
                    seq = DNA.makeSequence("N"*len(self))
            seq.Name = str(self.Location)
            self._cached['Seq'] = seq
            self._cached["Utr3"] = self.NULL_VALUE
            return
        Utr5_seq, Utr3_seq = DNA.makeSequence(""), DNA.makeSequence("")
        for exon in self.UntranslatedExons5:
            Utr5_seq += exon.Seq
        # check first exon PhaseStart is 0 and last exon PhaseEnd
        if exons[0].PhaseStart > 0:
            fill = DNA.makeSequence('N' * exons[0].PhaseStart, Name=full_seq.Name)
            full_seq = fill + full_seq
 
        if exons[-1].PhaseEnd > 0:
            fill = DNA.makeSequence('N' * exons[-1].PhaseEnd, Name=full_seq.Name)

src/p/y/pycogent-HEAD/cogent/db/ensembl/region.py   pycogent(Download)
                    seq = get_sequence(alt_loc)
                except NoItemError:
                    seq = DNA.makeSequence("N"*len(self))
            seq.Name = str(self.Location)
            self._cached['Seq'] = seq
            self._cached["Utr3"] = self.NULL_VALUE
            return
        Utr5_seq, Utr3_seq = DNA.makeSequence(""), DNA.makeSequence("")
        for exon in self.UntranslatedExons5:
            Utr5_seq += exon.Seq
        # check first exon PhaseStart is 0 and last exon PhaseEnd
        if exons[0].PhaseStart > 0:
            fill = DNA.makeSequence('N' * exons[0].PhaseStart, Name=full_seq.Name)
            full_seq = fill + full_seq
 
        if exons[-1].PhaseEnd > 0:
            fill = DNA.makeSequence('N' * exons[-1].PhaseEnd, Name=full_seq.Name)

src/e/e/eebprogramming-HEAD/lec10review/2annotations.py   eebprogramming(Download)
#!/usr/bin/env python
# taken from http://pycogent.sourceforge.net/
from cogent import DNA
s = DNA.makeSequence("aagaagaagacccccaaaaaaaaaattttttttttaaaaaaaaaaaaa", Name="Orig")
exon1 = s.addFeature('exon', 'exon1', [(10,15)])
exon2 = s.addFeature('exon', 'exon2', [(30,40)])
from cogent.core.annotation import Feature
s2=DNA.makeSequence("aagaagaagacccccaaaaaaaaaattttttttttaaaaaaaaaaaaa", Name="Orig2")

src/e/e/eebprogramming-HEAD/lec10review/annotations.py   eebprogramming(Download)
#!/usr/bin/env python
# taken from http://pycogent.sourceforge.net/
from cogent import DNA
from cogent.core.annotation import Feature
s = DNA.makeSequence("AAGAAGAAGACCCCCAAAAAAAAAATTTTTTTTTTAAAAAAAAAAAAA", Name="Orig")
region.detach()
len(s.annotations)
plus = DNA.makeSequence("AAGGGGAAAACCCCCAAAAAAAAAATTTTTTTTTTAAA", Name="plus")
plus_cds = plus.addAnnotation(Feature, 'CDS', 'gene',
                       [(2,6),(10,15),(25,35)])
print aln.getSeq('y')[exons[0].map.withoutGaps()]
aln = LoadSeqs(data=[['x', '-AAAAAAAAA'], ['y', 'TTTT--TTTT']])
s = DNA.makeSequence("AAAAAAAAA", Name="x")
exon = s.addAnnotation(Feature, 'exon', 'fred', [(3,8)])
exon = aln.getSeq('x').copyAnnotations(s)

src/c/o/cogent-1.5.3/cogent/db/ensembl/sequence.py   cogent(Download)
    assert diff >= 0, 'end[%s] < previous frag_end[%s]' % (end, frag_end)
    assembled += ['N' * diff]
    return DNA.makeSequence(''.join(assembled))
 
def _make_coord(genome, coord_name, start, end, strand):
        record = asserted_one(query.execute().fetchall())
        seq = record['sequence']
        seq = DNA.makeSequence(seq)
        if t_loc.Strand == -1:
            seq = seq.rc()

src/p/y/pycogent-HEAD/cogent/db/ensembl/sequence.py   pycogent(Download)
    assert diff >= 0, 'end[%s] < previous frag_end[%s]' % (end, frag_end)
    assembled += ['N' * diff]
    return DNA.makeSequence(''.join(assembled))
 
def _make_coord(genome, coord_name, start, end, strand):
        record = asserted_one(query.execute().fetchall())
        seq = record['sequence']
        seq = DNA.makeSequence(seq)
        if t_loc.Strand == -1:
            seq = seq.rc()

src/c/o/cogent-1.5.3/cogent/parse/cigar.py   cogent(Download)
                data[seqname] = seq[seq_loc[0]:seq_loc[1]].gappedByMap(m)
            else:
                data[seqname] = DNA.makeSequence('-'*(aln_loc[1] - aln_loc[0]))
    aln = LoadSeqs(data = data, aligned = True)
    return aln

src/c/o/cogent-1.5.3/cogent/app/blat.py   cogent(Download)
        seq_id = label.split()[0]
 
        s = DNA.makeSequence(sequence)
        translations = standard_code.sixframes(s)
        frames = [1,2,3,-1,-2,-3]

src/p/y/pycogent-HEAD/cogent/parse/cigar.py   pycogent(Download)
                data[seqname] = seq[seq_loc[0]:seq_loc[1]].gappedByMap(m)
            else:
                data[seqname] = DNA.makeSequence('-'*(aln_loc[1] - aln_loc[0]))
    aln = LoadSeqs(data = data, aligned = True)
    return aln

  1 | 2 | 3 | 4  Next