Did I find the right examples for you? yes no

All Samples(14)  |  Call(14)  |  Derive(0)  |  Import(0)

src/q/i/qiime-1.8.0/qiime/filter_otus_by_sample.py   qiime(Download)
    output_filepath2 = '%s/%s_sremoved.fasta' % (dir_path,filename)
    output_file2=open(output_filepath2,'w')
    output_file2.write(removed_seqs.toFasta())
    output_file2.close()
 
    output_filepath = '%s/%s_sfiltered.fasta' % (dir_path,filename)
    output_file=open(output_filepath,'w')
    output_file.write(filtered_seqs.toFasta())
    output_file.close()
 

src/e/e/eebprogramming-HEAD/lec10review/4translation.py   eebprogramming(Download)
        'rat': 'CTGAACAAGCAGCCACTTTCAAACAAGAAA'}
unaligned_DNA = LoadSeqs(data=seqs, moltype = DNA, aligned = False)
print unaligned_DNA.toFasta()
unaligned_aa = unaligned_DNA.getTranslation()
print unaligned_aa.toFasta()

src/e/e/eebprogramming-HEAD/lec10review/1readAndWrite.py   eebprogramming(Download)
#!/usr/bin/env python
# taken from http://pycogent.sourceforge.net/
from cogent import LoadSeqs, DNA
al = LoadSeqs('data/test2.fasta', moltype=DNA, aligned = False)
print al.toFasta()

src/q/i/qiime-1.8.0/tests/test_parallel/test_assign_taxonomy.py   qiime(Download)
            suffix='.fasta')
        seq_file = open(self.tmp_seq_filepath, 'w')
        seq_file.write(blast_test_seqs.toFasta())
        seq_file.close()
        self.files_to_remove.append(self.tmp_seq_filepath)
            prefix='qiime_parallel_taxonomy_assigner_tests_ref_seqs',
            suffix='.fasta',dir=tmp_dir)
        self.reference_seqs_file.write(blast_reference_seqs.toFasta())
        self.reference_seqs_file.seek(0)
 

src/q/i/qiime-1.8.0/tests/test_identify_chimeric_seqs.py   qiime(Download)
 
        open(self.id_to_taxonomy_fp,'w').write(id_to_taxonomy_string)
        open(self.input_seqs_fp,'w').write(test_seq_coll.toFasta())
        open(self.reference_seqs_fp,'w').write(test_refseq_coll.toFasta())
 

src/q/i/qiime-1.8.0/tests/test_assign_taxonomy.py   qiime(Download)
 
        open(self.id_to_taxonomy_fp,'w').write(id_to_taxonomy_string)
        open(self.input_seqs_fp,'w').write(test_seq_coll.toFasta())
        self.test_seqs = test_seq_coll.items()
        open(self.reference_seqs_fp,'w').write(test_refseq_coll.toFasta())
        input_seqs_file = NamedTemporaryFile(
            prefix='RdpTaxonAssignerTest_', suffix='.fasta')
        input_seqs_file.write(test_seq_coll.toFasta())
        input_seqs_file.seek(0)
 
        input_seqs_file = NamedTemporaryFile(
            prefix='RdpTaxonAssignerTest_', suffix='.fasta')
        input_seqs_file.write(test_seq_coll.toFasta())
        input_seqs_file.seek(0)
 

src/q/i/qiime-1.8.0/tests/test_align_seqs.py   qiime(Download)
 
        actual_fail = LoadSeqs(self.failure_fp,aligned=False)
        self.assertEqual(actual_fail.toFasta(),\
                         self.pynast_test1_expected_fail.toFasta())
 

src/p/y/pynast-1.2.2/tests/test_util.py   pynast(Download)
         full_length_test1_template_aln_f.name
        full_length_test1_template_aln_f.write(
         self.full_length_test1_template_aln.toFasta())
        full_length_test1_template_aln_f.close()
        self.files_to_remove.append(self.full_length_test1_template_aln_fp)