Did I find the right examples for you? yes no

All Samples(16)  |  Call(0)  |  Derive(0)  |  Import(16)

src/c/o/cogent-1.5.3/cogent/evolve/coevolution.py   cogent(Download)
from cogent.parse.record import FileFormatError
from cogent.evolve.substitution_model import SubstitutionModel
from cogent import LoadSeqs, LoadTree, PROTEIN, RNA
from cogent.core.tree import TreeError
from cogent.core.alignment import seqs_from_fasta, DenseAlignment
def gctmpca_pair(aln,tree,pos1,pos2,epsilon=None,priors=None,sub_matrix=None,\
    null_value=gDefaultNullValue,debug=False):
    seqs1, tree1, seq_names, seq_to_species1 = create_gctmpca_input(aln,tree) 
 
    if aln.MolType == PROTEIN: mol_type = 'protein'
def gctmpca_alignment(aln,tree,epsilon=None,priors=None,\
    sub_matrix=None,null_value=gDefaultNullValue,debug=False):
    seqs1, tree1, seq_names, seq_to_species1 = create_gctmpca_input(aln,tree) 
 
    if aln.MolType == PROTEIN: mol_type = 'protein'
    # users must provide background frequencies for MolTypes other 
    # than PROTEIN -- by default, protein background frequencies are used.
    if alignment.MolType != PROTEIN: 
        required_parameters.append('background_freqs')
    for rp in required_parameters:
        # We want to use the PROTEIN alphabet minus the U character for 
        # proteins since we don't have a background frequency for U
        if alignment.MolType == PROTEIN: alphabet = AAGapless
        else: alphabet = alignment.MolType.Alphabet
    try:

src/p/y/pycogent-HEAD/cogent/evolve/coevolution.py   pycogent(Download)
from cogent.parse.record import FileFormatError
from cogent.evolve.substitution_model import SubstitutionModel
from cogent import LoadSeqs, LoadTree, PROTEIN, RNA
from cogent.core.tree import TreeError
from cogent.core.alignment import seqs_from_fasta, DenseAlignment
def gctmpca_pair(aln,tree,pos1,pos2,epsilon=None,priors=None,sub_matrix=None,\
    null_value=gDefaultNullValue,debug=False):
    seqs1, tree1, seq_names, seq_to_species1 = create_gctmpca_input(aln,tree) 
 
    if aln.MolType == PROTEIN: mol_type = 'protein'
def gctmpca_alignment(aln,tree,epsilon=None,priors=None,\
    sub_matrix=None,null_value=gDefaultNullValue,debug=False):
    seqs1, tree1, seq_names, seq_to_species1 = create_gctmpca_input(aln,tree) 
 
    if aln.MolType == PROTEIN: mol_type = 'protein'
    # users must provide background frequencies for MolTypes other 
    # than PROTEIN -- by default, protein background frequencies are used.
    if alignment.MolType != PROTEIN: 
        required_parameters.append('background_freqs')
    for rp in required_parameters:
        # We want to use the PROTEIN alphabet minus the U character for 
        # proteins since we don't have a background frequency for U
        if alignment.MolType == PROTEIN: alphabet = AAGapless
        else: alphabet = alignment.MolType.Alphabet
    try:

src/e/e/eebprogramming-HEAD/lec10review/4translation.py   eebprogramming(Download)
#!/usr/bin/env python
# taken from http://pycogent.sourceforge.net/
from cogent import LoadSeqs, DNA, PROTEIN
seqs = {'hum': 'AAGCAGATCCAGGAAAGCAGCGAGAATGGCAGCCTGGCCGCGCGCCAGGAGAGGCAGGCCCAGGTCAACCTCACT',
        'mus': 'AAGCAGATCCAGGAGAGCGGCGAGAGCGGCAGCCTGGCCGCGCGGCAGGAGAGGCAGGCCCAAGTCAACCTCACG',
        'mus': 'KQIQESGESGSLAARQERQAQVNLT',
        'rat': 'LNKQ------PLS---------NKK'}
aligned_aa = LoadSeqs(data = aligned_aa_seqs, moltype = PROTEIN)
aligned_DNA = aligned_aa.replaceSeqs(unaligned_DNA)
print aligned_DNA

src/c/o/cogent-1.5.3/cogent/core/entity.py   cogent(Download)
        if moltype == 'PROTEIN':
            valid_names = AA_NAMES
            moltype = cogent.PROTEIN
        elif moltype == 'DNA':
            raise NotImplementedError('The sequence type: %s is not implemented' % moltype)

src/c/o/cogent-1.5.3/cogent/app/blat.py   cogent(Download)
from cogent.app.util import CommandLineApplication, ResultPath, \
                            ApplicationError, get_tmp_filename
from cogent import DNA, PROTEIN
from cogent.core.genetic_code import DEFAULT as standard_code
from cogent.parse.fasta import MinimalFastaParser

src/p/y/pycogent-HEAD/cogent/core/entity.py   pycogent(Download)
        if moltype == 'PROTEIN':
            valid_names = AA_NAMES
            moltype = cogent.PROTEIN
        elif moltype == 'DNA':
            raise NotImplementedError('The sequence type: %s is not implemented' % moltype)

src/p/y/pycogent-HEAD/cogent/app/blat.py   pycogent(Download)
from cogent.app.util import CommandLineApplication, ResultPath, \
                            ApplicationError, get_tmp_filename
from cogent import DNA, PROTEIN
from cogent.core.genetic_code import DEFAULT as standard_code
from cogent.parse.fasta import MinimalFastaParser

src/q/i/qiime-1.8.0/qiime/pycogent_backports/blat.py   qiime(Download)
from cogent.app.util import CommandLineApplication, ResultPath, \
                            ApplicationError, get_tmp_filename
from cogent import DNA, PROTEIN
from cogent.core.genetic_code import GeneticCodes
from cogent.parse.fasta import MinimalFastaParser

src/c/o/cogent-1.5.3/cogent/util/recode_alignment.py   cogent(Download)
from cogent.core.alignment import DenseAlignment, Alignment
from cogent.evolve.models import DSO78_matrix, DSO78_freqs
from cogent import PROTEIN
 
__author__ = "Greg Caporaso"

src/p/y/pycogent-HEAD/cogent/util/recode_alignment.py   pycogent(Download)
from cogent.core.alignment import DenseAlignment, Alignment
from cogent.evolve.models import DSO78_matrix, DSO78_freqs
from cogent import PROTEIN
 
__author__ = "Greg Caporaso"

  1 | 2  Next