Did I find the right examples for you? yes no

All Samples(34)  |  Call(24)  |  Derive(0)  |  Import(10)

src/p/y/pynast-1.2.2/pynast/util.py   pynast(Download)
from glob import glob
 
from cogent import DNA, LoadSeqs, Sequence
from cogent.util.misc import remove_files
from cogent.core.alignment import SequenceCollection, DenseAlignment
        for seq_id,seq in MinimalFastaParser(template_alignment_f):
            template_alignment[seq_id] = seq
            seq = Sequence(seq=seq,moltype=DNA)
            template_fasta_f.write('>%s\n%s\n' % (seq_id,seq.degap()))
    else:
            except AttributeError:
                template_aligned_seq = \
                 Sequence(seq=template_alignment[template_seq_id],moltype=DNA)
 
            # reintroduce the gap spacing from the template alignment

src/q/i/qiime-1.8.0/qiime/denoiser/utils.py   qiime(Download)
import pickle
 
from cogent import Sequence
 
from cogent.app.util import ApplicationNotFoundError,ApplicationError
    for (label,seq) in seqs:
        if(mapping.has_key(label)):            
            seq  = Sequence(name = "%s: %d" %(label, len(mapping[label])+1),
                            seq = seq)
            yield seq

src/c/o/cogent-1.5.3/cogent/core/entity.py   cogent(Download)
        raw_seq = "".join(raw_seq)
 
        seq = cogent.Sequence(moltype, raw_seq, self.getName())
        seq.addAnnotation(SimpleVariable, 'entity_id', 'S_id', full_ids)
        return seq

src/p/y/pycogent-HEAD/cogent/core/entity.py   pycogent(Download)
        raw_seq = "".join(raw_seq)
 
        seq = cogent.Sequence(moltype, raw_seq, self.getName())
        seq.addAnnotation(SimpleVariable, 'entity_id', 'S_id', full_ids)
        return seq

src/q/i/qiime-1.8.0/qiime/util.py   qiime(Download)
 
from cogent.util.dict2d import Dict2D
from cogent import LoadSeqs, Sequence,DNA
from cogent.parse.tree import DndParser
from cogent.core.tree import PhyloNode

src/c/o/cogent-1.5.3/tests/test_core/test_core_standalone.py   cogent(Download)
import unittest, os, tempfile
 
from cogent import DNA, RNA, STANDARD_CODON as CODON, PROTEIN, Sequence, \
                LoadSeqs
from cogent.parse.record import FileFormatError
    def setUp(self):
        self.seq = Sequence(DNA,  'ATGACGTTGCGTAGCATAGCTCGA')
 
    def test_getlength(self):
        """testing getting length"""
    def test_reversecomplement(self):
        """testing reversal and complementing of a sequence"""
        seq = Sequence(DNA, seq='ACTGTAA')
        rev = seq.reversecomplement()
        self.assertEqual(str(rev), 'TTACAGT')
        seq = Sequence(DNA, seq='ACTG-TAA')
        rev = seq.reversecomplement()
        self.assertEqual(str(rev), 'TTA-CAGT')
        #try amigbuities
        seq = Sequence(DNA, seq='ACHNRTAA')

src/p/y/pycogent-HEAD/tests/test_core/test_core_standalone.py   pycogent(Download)
import unittest, os, tempfile
 
from cogent import DNA, RNA, STANDARD_CODON as CODON, PROTEIN, Sequence, \
                LoadSeqs
from cogent.parse.record import FileFormatError
    def setUp(self):
        self.seq = Sequence(DNA,  'ATGACGTTGCGTAGCATAGCTCGA')
 
    def test_getlength(self):
        """testing getting length"""
    def test_reversecomplement(self):
        """testing reversal and complementing of a sequence"""
        seq = Sequence(DNA, seq='ACTGTAA')
        rev = seq.reversecomplement()
        self.assertEqual(str(rev), 'TTACAGT')
        seq = Sequence(DNA, seq='ACTG-TAA')
        rev = seq.reversecomplement()
        self.assertEqual(str(rev), 'TTA-CAGT')
        #try amigbuities
        seq = Sequence(DNA, seq='ACHNRTAA')

src/q/i/qiime-1.8.0/tests/test_denoiser/test_utils.py   qiime(Download)
from cogent.util.unit_test import TestCase, main
 
from cogent import Sequence
from cogent.parse.fasta import MinimalFastaParser
from cogent.parse.flowgram import Flowgram
 
      observed = list(get_representatives(mapping, seqs))
      expected = [Sequence(name = ">1", seq="ACGT"), Sequence(name='2',
                                                              seq="TAGC")]
      self.assertEqual(observed, expected)

src/q/i/qiime-1.8.0/qiime/denoiser/denoise_postprocess.py   qiime(Download)
from re import compile, search
 
from cogent import Sequence
from cogent.parse.fasta import MinimalFastaParser
 

src/q/i/qiime-1.8.0/qiime/format.py   qiime(Download)
from numpy import asarray, isnan, log10, median
from StringIO import StringIO
from cogent import Sequence
from re import compile, sub
from os import walk

  1 | 2  Next