Did I find the right examples for you? yes no

All Samples(10)  |  Call(8)  |  Derive(0)  |  Import(2)

src/c/o/cogent-1.5.3/tests/test_util/test_misc.py   cogent(Download)
from cogent.app.util import get_tmp_filename
from cogent.util.unit_test import TestCase, main
from cogent.util.misc import (iterable, max_index, min_index,
    flatten, is_iterable, is_char, is_char_or_noniterable,
    is_str_or_noniterable, not_list_tuple, list_flatten,
        user_input = "ATGCAGGGGAAACATGATTCAGGAC"
        correct_output = "GTCCTGAATCATGTTTCCCCTGCAT"
        real_output = reverse_complement(user_input)
        self.assertEquals(real_output, correct_output)
 
 
        #remember to use False toggle to get RNA instead of DNA
        real_output = reverse_complement(user_input, False)
        self.assertEquals(real_output, correct_output)        
    #end test_reverse_complement_RNA
        user_input = "aCGtAcgT"
        correct_output = "AcgTaCGt"
        real_output = reverse_complement(user_input)
        self.assertEquals(real_output, correct_output) 
    #end test_reverse_complement_caseSensitive
    def test_reverse_complement_emptySeq(self):
        """reverse_complement should return empty string if given empty sequence"""
 
        #shouldn't matter whether in DNA or RNA mode
        real_output = reverse_complement("")

src/p/y/pycogent-HEAD/tests/test_util/test_misc.py   pycogent(Download)
from cogent.app.util import get_tmp_filename
from cogent.util.unit_test import TestCase, main
from cogent.util.misc import (iterable, max_index, min_index,
    flatten, is_iterable, is_char, is_char_or_noniterable,
    is_str_or_noniterable, not_list_tuple, list_flatten,
        user_input = "ATGCAGGGGAAACATGATTCAGGAC"
        correct_output = "GTCCTGAATCATGTTTCCCCTGCAT"
        real_output = reverse_complement(user_input)
        self.assertEquals(real_output, correct_output)
 
 
        #remember to use False toggle to get RNA instead of DNA
        real_output = reverse_complement(user_input, False)
        self.assertEquals(real_output, correct_output)        
    #end test_reverse_complement_RNA
        user_input = "aCGtAcgT"
        correct_output = "AcgTaCGt"
        real_output = reverse_complement(user_input)
        self.assertEquals(real_output, correct_output) 
    #end test_reverse_complement_caseSensitive
    def test_reverse_complement_emptySeq(self):
        """reverse_complement should return empty string if given empty sequence"""
 
        #shouldn't matter whether in DNA or RNA mode
        real_output = reverse_complement("")