# Copyright 2003-2009 by Bartek Wilczynski.  All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license.  Please see the LICENSE file that should have been included
# as part of this package.
"""Tools for sequence motif analysis (DEPRECATED, see Bio.motifs instead).
 
This module (Bio.Motif) has been deprecated and will be removed in a
future release of release of Biopython. Please use the new module
Bio.motifs instead.
 
This contains the core Motif class containing various I/O methods as
well as methods for motif comparisons and motif searching in sequences.
It also inlcudes functionality for parsing AlignACE and MEME programs.
"""
 
from __future__ import print_function
 
import warnings
from Bio import BiopythonDeprecationWarning
warnings.warn("The module Bio.Motif has been deprecated and will be "
              "removed in a future release of Biopython. Instead "
              "please use the new module Bio.motifs instead. Please "
              "be aware that though the functionality of Bio.Motif "
              "is retained (and extended) in Bio.motifs, usage may "
              "be different.",
              BiopythonDeprecationWarning)
 
 
from Bio.Motif._Motif import Motif
from Bio.Motif.Parsers.AlignAce import read as _AlignAce_read
from Bio.Motif.Parsers.MEME import read as _MEME_read
from Bio.Motif.Thresholds import ScoreDistribution
 
_parsers={"AlignAce": _AlignAce_read,
          "MEME": _MEME_read,
          }
 
def _from_pfm(handle):
    return Motif()._from_jaspar_pfm(handle)
 
def _from_sites(handle):
    return Motif()._from_jaspar_sites(handle)
 
_readers={"jaspar-pfm": _from_pfm,
          "jaspar-sites": _from_sites
          }
 
 
 
def parse(handle, format):
    """Parses an output file of motif finding programs.
 
    Currently supported formats:
     - AlignAce
     - MEME
 
    You can also use single-motif formats, although the Bio.Motif.read()
    function is simpler to use in this situation.
     - jaspar-pfm
     - jaspar-sites
 
    For example:
 
    >>> from Bio import Motif
    >>> with open("Motif/alignace.out") as handle:
    ...     for motif in Motif.parse(handle, "AlignAce"):
    ...         print(motif.consensus())
    ...
    TCTACGATTGAG
    CTGCACCTAGCTACGAGTGAG
    GTGCCCTAAGCATACTAGGCG
    GCCACTAGCAGAGCAGGGGGC
    CGACTCAGAGGTT
    CCACGCTAAGAGAAGTGCCGGAG
    GCACGTCCCTGAGCA
    GTCCATCGCAAAGCGTGGGGC
    GAGATCAGAGGGCCG
    TGGACGCGGGG
    GACCAGAGCCTCGCATGGGGG
    AGCGCGCGTG
    GCCGGTTGCTGTTCATTAGG
    ACCGACGGCAGCTAAAAGGG
    GACGCCGGGGAT
    CGACTCGCGCTTACAAGG
    """
    try:
        parser=_parsers[format]
 
    except KeyError:
        try: #not a true parser, try reader formats
            reader=_readers[format]
        except:
            raise ValueError("Wrong parser format")
        else: #we have a proper reader 
            yield reader(handle)
    else: # we have a proper reader
        for m in parser(handle).motifs:
            yield m
 
def read(handle, format):
    """Reads a motif from a handle using a specified file-format.
 
    This supports the same formats as Bio.Motif.parse(), but
    only for files containing exactly one record.  For example,
    reading a pfm file:
 
    >>> from Bio import Motif
    >>> with open("Motif/SRF.pfm") as handle:
    ...     motif = Motif.read(handle, "jaspar-pfm")
    ...
    >>> motif.consensus()
    Seq('GCCCATATATGG', IUPACUnambiguousDNA())
 
    Or a single-motif MEME file,
 
    >>> from Bio import Motif
    >>> with open("Motif/meme.out") as handle:
    ...     motif =  Motif.read(handle, "MEME")
    ...
    >>> motif.consensus()
    Seq('CTCAATCGTA', IUPACUnambiguousDNA())
 
    If the handle contains no records, or more than one record,
    an exception is raised:
 
    >>> from Bio import Motif
    >>> with open("Motif/alignace.out") as handle:
    ...     motif = Motif.read(handle, "AlignAce")
    ...
    Traceback (most recent call last):
        ...
    ValueError: More than one motif found in handle
 
    If however you want the first record from a file containing
    multiple records this function would raise an exception (as
    shown in the example above).  Instead use:
 
    >>> from Bio import Motif
    >>> with open("Motif/alignace.out") as handle:
    ...    motif = next(Motif.parse(handle, "AlignAce"))
    ...
    >>> motif.consensus()
    Seq('TCTACGATTGAG', IUPACUnambiguousDNA())
 
    Use the Bio.Motif.parse(handle, format) function if you want
    to read multiple records from the handle.
    """
    iterator = parse(handle, format)
    try:
        first = next(iterator)
    except StopIteration:
        first = None
    if first is None:
        raise ValueError("No motifs found in handle")
    try:
        second = next(iterator)
    except StopIteration:
        second = None
    if second is not None:
        raise ValueError("More than one motif found in handle")
    return first
 
 
if __name__ == "__main__":
    from Bio._utils import run_doctest
    run_doctest(verbose=0)